Examples of MALDI-TOF SpectrogramsAnalysed using the device MALDI-TOF Autoflex II (Bruker) in the linear mode, using the trap MTP AnchorChipTM and 3-hydroxypicolinic acid as the matrix. | ID | Sequence | calculated MW | measured MW | | seqA | TGCAGCGGCCCCACCTAT | 5420,6 | 5423,8 | | seqB | TGGCTCTATTTTCACATCTTAACC | 7228,7 | 7228,7 |
|
Oligonucleotide seqB is a very high-quality and no sequential impurities are present. Oligonucleotide seqA is a very low-quality oligonucleotide where full coupling efficiency (especially of G and A bases) was not achieved and the oligonucleotide sequence can be "read". Note: A similar record (as in seqA) can be intentionally achieved upon sequencing of oligonucleotides using the MALDI-TOF technique, so called "in-source decay".
High-quality oligo - SeqB
Low-quality oligo - SeqA
|