Generi Biotech - Compounds and Services for Molecular Biology

• Real-Time PCR Probes
  • CATALOGUE AND PRICELIST
  • Dual Labelled Probes
  • Mono Labelled Probes
  • Delivery Terms and Conditions
  • Order probes
• Oligonucleotides
  • Synthesis Scale
  • Oligo Purification
  • Quality Control
  • CATALOGUE AND PRICELIST
  • Oligos without Modification
  • 3´ end modified oligos
  • 5´ end modified oligos
  • Phosphate Bond Modifications
  • Ribose Modifications
  • RNA Oligos
  • Other Modifications
  • Oligo EXPRESS 24
  • Terms and Conditions
  • Order Oligo
• Oligos on array
  • Pricelist
• MY OLIGO
  • Instructions
  • Search
  • MY OLIGO - Demo
  • Advanced Options

Oligonucleotide Stability

Oligonucleotides are highly stable substances that preserve their biological efficiency (for example, capability of PCR reaction) for many years if kept at temperatures approximately -20°C. It is assumed that frequent unfreezing and refreezing may lead to reduction of their functionality, therefore (and also in order to reduce the probability of contamination by PCR products) it is recommended to keep oligos in aliquot parts. However, our own experience shows that oligonucleotides remain stabile even if subjected to very poor treatment.

Oligonucleotide stability test

The oligonucleotides 5´GGGTCTCTCCTCCACCTTGCAGG 3´ and 5´CCAGGGGTCCCAACTCACATCG 3´ were dissolved in distilled water in the concentration 50 nmol/µL.

Test A type: During 20 days, oligonucleotide solutions were subjected to 75 temperature cycles: Freezing to -20°C, keeping at -20°C for more than 1 hour, unfreezing and incubation for 1 hour at 37°C.

Test B type: Same as variant A; moreover, upon every unfreezing step, oligonucleotide solutions were transferred to always the same tips using a pipette; the tips were not replaced during the test that lasted 20 days, and were kept freely on the normal working surface in a regular laboratory.)

None of the tested oligonucleotides (4 pairs were tested) showed any modification upon any of these tests that would lead to any change of the chromatogram or to any change of the result upon their application in a PCR reaction executed under standard conditions.

Fig. 1: Chromatogram of the oligonucleotide 5´ GGGTCTCTCCTCCACCTTGCAGG 3´ kept under standard conditions (-20 °C)

Fig. 2: Chromatogram of the oligonucleotide 5´ GGGTCTCTCCTCCACCTTGCAGG 3´ that was subjected to the stability test A

Fig. 3: Chromatogram of the oligonucleotide 5´ CCAGGGGTCCCAACTCACATCG 3´ kept under standard conditions (-20 °C)

Fig. 4: Chromatogram of the oligonucleotide 5´ GGGTCTCTCCTCCACCTTGCAGG 3´ that was subjected to the stability test B

Fig. 5: Pit 1 (from the left): marker; pits 2, 3: product of the PCR reaction using primers kept under standard conditions (pits 2 and 3 differ in the used DNA); pits 4, 5: product of the PCR reaction using primers that were subjected to the stability test A (pits 2 and 3 differ in the used DNA); pits 6, 7: product of the PCR reaction using primers that were subjected to the stability test B (pits 6 and 7 differ in the used DNA). PCR: annealing 55°C, 1 min, 4.5 mM Mg2+.