Stability of oligonucleotides

A chromatogram of oligo 5'GGGTCTCTCCTCCACCTTGCAGG 3' stored under standard conditions (-20°C).	A chromatogram of oligo 5'CCAGGGGTCCCAACTCACATCG 3' stored under standard conditions (-20°C).
A chromatogram of oligo 5'GGGTCTCTCCTCCACCTTGCAGG 3', which passed a test of stability A (see below).	A chromatogram of oligo 5'CCAGGGGTCCCAACTCACATCG 3', which passed a test of stability B (see below).
	Well 1 (from the left side): marker; wells 2, 3: products of PCR reaction using usualy stored primers (wells 2 and 3 differ by used template DNA); wells 4 and 5: products of PCR reaction using primers that passed a test of stability A (wells 2 and 3 differ by used DNA); wells 6, 7: product of PCR reaction using primers that passed a test of stability B (wells 6 a 7 differ by used DNA). PCR: annealing 55°C, 1 min., 4.5 mM Mg 2+.

Stability test: oligonucleotides 5' GGGTCTCTCCTCCACCTTGCAGG 3' and 5'CCAGGGGTCCCAACTCACATCG 3' were dissolved in distilled water to have a concentration of 50 nmol/µl.
Test A: in a period of 20 days, solutions of oligos were subjected to 75 temperature cycles: freezing to -20°C, storage at -20°C for more than one hour, melting and incubation for 1 hour at 37°C.
Test B: the same as test A, but even after each melting, each solution of the oligo was pipetted using the same tip that had not been changed in the period of 20-day testing. The pipettes were left out on a working surface in a laboratory. None of the tested samples of oligonucleotides (4 pairs were tested) were altered by any of the tests in a way that would change the chromatogram or the results, when oligos were used in PCR reaction performed under standard conditions.