Categories

qPCR assays for detection of SARS-CoV-2 (Wuhan coronavirus 2019)

qPCR assays for detection of SARS-CoV-2 (Wuhan coronavirus 2019)

The product is 4x concentrated mix of 2 primers and a hydrolysis probe. In combination with the reaction mixture (we recommend specific Master Mix – gb OneStep IPC Elite RT-qPCR Kit) it is used for qPCR to detect SARS-CoV-2 (Wuhan coronavirus 2019) according to protocol published by Charité Berlin.

Principle of the assays

Assay E_Sarbeco (Cat. No. 3062-) – its target is E gene, it is used as a primary assay for detection. The assay contains sequences as follows:

name sequence concentration  in PCR
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 400 nM
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 400 nM
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 200 nM

 

Assay RdRP_SARSr (Cat. No. 3063-) – its target is RdRP gene, it is used as a confirmation assay for positively assessed samples tested by E_Sarbeco assay. The assay contains sequences as follows:

name sequence concentration in PCR
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG 400 nM
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA 400 nM
RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1 200 nM

When qPCR analyses are run with the recommended mastemix, the same temperature profile for both assays can be used. See link.

Product parameters

  • 4x concentrated mix of primers and probe (FAM labeled)
  • assays have the same temperature profile
Cat. No. Product No. of reactions Price
3062 Assay E_Sarbeco 100
Add to Quote
Add to Quote
3063 Assay RdRP_SARSr 100
Add to Quote
Add to Quote

Shiping on dry ice from € 95 (EU)
For other destinations see indicative list.

Useful links
Recommended products
New
gb OneStep IPC Elite RT-qPCR Kit

gb OneStep IPC Elite RT-qPCR Kit gb OneStep IPC Elite RT-qPCR Kit

gb OneStep IPC Elite RT-qPCR Kit falls into a group of TaqMan Real-Time PCR Master Mixes. It provides cDNA synthesis and qPCR in one-step. The product is intended for high sensitivity reverse transcription (RT) and real-time PCR (qPCR) performed in one step (in one reaction), i.e. onestep RT-qPCR. No additional instrumentation is required. The kit contains IPC.

More